• Creator: sina12345
• Population: 1
• Generation: 7
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: ACTCGCAACATACCACAGAGCATCGTCGTCCTA
• Function:

  2 *(round(square(logn(product(minus(numbers('xry'), numbers('rep')), numbers('xry')))), logn(product(minus(numbers('xry'), numbers('rep')), numbers('xry')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.