• Creator: sina12345
• Population: 1
• Generation: 8
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 05/19/2019
• Genome: GAACAGACCAAGAGACGCGCCTGCTCGGTTCTA
• Function:

  sin(round(numbers('yyx'), numbers('xry'))) if 10 *(invert(sin(round(numbers('yyx'), numbers('xry'))))) > invert(sin(round(numbers('yyx'), numbers('xry')))) else minus(10 *(invert(sin(round(numbers('yyx'), numbers('xry'))))), invert(sin(round(numbers('yyx'), numbers('xry')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.