• Creator: sina12345
• Population: 1
• Generation: 9
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: AGGACTCGCAACAACCTTGTGAGCATCGTCGTCCAA
• Function:

  tan(2 *(round(square(square(round(numbers('epe'), numbers('xry')))), square(round(numbers('epe'), numbers('xry'))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.