• Creator: guest73
• Population: 0
• Generation: 0
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: CGACCTGGTACAAGGTGGAGATCTTTAAAT
• Function:

  mod(divide(gradient[2](tan(numbers('yxr'))) if numbers('yxr') > numbers("xxr") else tan(numbers('yxr')), gradient[2](tan(numbers('yxr')))), numbers("xxr") if tan(numbers('yxr')) > numbers('yxr') else gradient[2](tan(numbers('yxr'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.