• Creator: guest73
• Population: 0
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: CTTGATACGAAGAAACGCGCGCCCTCTAAG
• Function:

  round(abs(numbers('xry')) if numbers('xry') > 100 *(invert(abs(numbers('xry')))) else invert(abs(numbers('xry'))), 100 *(invert(abs(numbers('xry')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.