• Creator: guest73
• Population: 0
• Generation: 2
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: TGCCGACCTGGTACAAGGTGGAATCCTGGCAGT
• Function:

  mod(divide(tan(numbers('yxr')) if numbers("yxx") > gradient[2](tan(numbers('yxr'))) else numbers('yxr'), gradient[2](tan(numbers('yxr')))), tan(numbers('yxr')) if numbers("yxx") > gradient[2](tan(numbers('yxr'))) else numbers('yxr')) if tan(numbers('yxr')) if gradient[2](tan(numbers('yxr'))) > numbers('yxr') else numbers("yxx") > gradient[2](tan(numbers('yxr'))) else divide(numbers("yxx") if tan(numbers('yxr')) > numbers('yxr') else gradient[2](tan(numbers('yxr'))), gradient[2](tan(numbers('yxr'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.