• Creator: guest73
• Population: 0
• Generation: 2
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: TGCCGACCTGGTACAAGGTGGAATCCTGGCAGT
• Function:

  divide(tan(numbers('yxr')) if numbers('yxr') > numbers("yxx") else gradient[2](tan(numbers('yxr'))), gradient[2](tan(numbers('yxr')))) if mod(divide(gradient[2](tan(numbers('yxr'))) if tan(numbers('yxr')) > numbers('yxr') else numbers("yxx"), gradient[2](tan(numbers('yxr')))), numbers("yxx") if numbers('yxr') > tan(numbers('yxr')) else gradient[2](tan(numbers('yxr')))) > gradient[2](tan(numbers('yxr'))) if numbers("yxx") > numbers('yxr') else tan(numbers('yxr')) else gradient[2](tan(numbers('yxr')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.