• Creator: sina12345
• Population: 0 (Global)
• Generation: 2
• Total Fitness: 15
• No. Votes: 3
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: ACCCCGCCGAGGCTCCGACCGAGGGGTTTCCCC
• Function:

  10 *(divide(divide(tan(min(mod(numbers('yxy'), numbers('yxr')), numbers('yxy'))), min(mod(numbers('yxy'), numbers('yxr')), numbers('yxy'))), tan(min(mod(numbers('yxy'), numbers('yxr')), numbers('yxy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.