• Creator: guest2610
• Population: 0
• Generation: 0
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 09/06/2020
• Genome: CCACAGAAGCCCCAGGAAGTCGCGAACGTG
• Function:

  product(minus(invert(product(minus(numbers("xxx"), numbers('rep')), numbers("xxx"))), product(minus(numbers("xxx"), numbers('rep')), numbers("xxx"))), invert(product(minus(numbers("xxx"), numbers('rep')), numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.