header

genetic-algorithms.com

 

Inspect guest79_0_3_15

Parents

Mother

Image 01

guest79_0_2_2

Genome: CGACAATCATTGACCTGCGAGAAATCATTC

Father

Image 01

guest79_0_2_1

Genome: GAGTGGCCTACCGTGCTCTCCCGTACGGGC

guest79_0_3_15

Image 01

  • Creator: guest79
  • Population: 0
  • Generation: 3
  • Total Fitness: 20
  • No. Votes: 2
  • Avg. Fitness 10
  • Created: 05/19/2019
  • Genome: CGACAATCTTCCGTGCTCTCCCGTACAATC
  • Function:

    mod(sum(numbers('yyx') if numbers('ryy') if numbers('rep') > numbers('yyx') else numbers("yyy") > numbers('rep') else numbers('yyx') if numbers('rep') > numbers("yyy") else numbers('ryy') if numbers('yyx') > numbers('rep') else numbers('ryy'), numbers('ryy') if numbers("yyy") > numbers('yyx') else numbers('rep') if numbers('rep') > numbers('yyx') else numbers('ryy')), numbers('ryy') if numbers('rep') > numbers('yyx') else numbers("yyy") if numbers('ryy') > numbers('rep') else numbers('yyx') if numbers('rep') > numbers("yyy") if numbers('rep') > numbers('yyx') else numbers('ryy') else numbers('yyx'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest79_0_4_14

Image 01

Genome: GTGCATGTATAGCCTATGATCTCTCGTACAATC

guest79_0_4_1

Image 01

Genome: ATCCGACAATCTTCCGTGCTCTCTCGTACAATC