• Creator: guest79
• Population: 0
• Generation: 4
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: TTGGGAGTCCCTATGACTCGCCATACGAACAGTAAG
• Function:

  sqrt(2 *(numbers('xry'))) if 2 *(numbers('xry')) > divide(sqrt(2 *(numbers('xry'))), 2 *(numbers('xry'))) else numbers('xry') if sqrt(2 *(numbers('xry'))) if sqrt(2 *(numbers('xry'))) if 2 *(numbers('xry')) > numbers('xry') else divide(sqrt(2 *(numbers('xry'))), 2 *(numbers('xry'))) > divide(sqrt(2 *(numbers('xry'))), 2 *(numbers('xry'))) else 2 *(numbers('xry')) > sqrt(2 *(numbers('xry'))) else divide(sqrt(2 *(numbers('xry'))), 2 *(numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.