• Creator: americanmoney9
• Population: 0
• Generation: 0
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 09/18/2020
• Genome: CTTGGCACGACAACTGGGGCATATTCATGT
• Function:

  round(numbers('yxr') if 2 *(numbers('yxr')) > gradient[2](2 *(numbers('yxr'))) else 100 *(gradient[2](2 *(numbers('yxr')))), 100 *(gradient[2](2 *(numbers('yxr')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.