• Creator: americanmoney9
• Population: 0
• Generation: 0
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 09/18/2020
• Genome: AATCGAGCTAATACTAGTTTCTTGAAAACT
• Function:

  noise(mod(2 *(numbers('ryy')) if numbers('ryy') > numbers('rep') else noise(2 *(numbers('ryy'))), noise(2 *(numbers('ryy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.