• Creator: guest6
• Population: 0
• Generation: 1
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: CTCCTTCAAAAAAAGTGCTGCAATGACAGG
• Function:

  min(round(sum(abs(invert(numbers('xry'))), invert(numbers('xry'))), abs(invert(numbers('xry')))), sum(abs(invert(numbers('xry'))), invert(numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.