• Creator: guest6
• Population: 0
• Generation: 2
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: ACGAATGGATCCGCCACCGGGCCTTACAAGGCG
• Function:

  100 *(noise(10 *(numbers('yxr')) if numbers('yxr') > numbers('yxr') if numbers("xxy") > numbers('xyy') else 10 *(numbers('yxr')) else numbers('yxr') if numbers('xyy') if 10 *(numbers('yxr')) > numbers('yxr') else numbers("xxy") > numbers('xyy') else 10 *(numbers('yxr'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.