• Creator: guest6
• Population: 0
• Generation: 2
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: AATGGGACGCCGCCTCCCCGCCGCCAGTTATGA
• Function:

  noise(divide(product(numbers('xry'), numbers('xry')), numbers('xry')) if product(numbers('xry'), numbers('xry')) > divide(divide(product(numbers('xry'), numbers('xry')), numbers('xry')), product(numbers('xry'), numbers('xry'))) else 100 *(divide(divide(product(numbers('xry'), numbers('xry')), numbers('xry')), product(numbers('xry'), numbers('xry')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.