• Creator: guest98
• Population: 0
• Generation: 3
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: AACAGCTGAACTATGCGATCCGACTATTAATTG
• Function:

  square(cos(mod(numbers('yyx'), numbers("xxy")) if numbers('yyx') > sqrt(mod(numbers('yyx'), numbers("xxy"))) else 2 *(sqrt(mod(numbers('yyx'), numbers("xxy"))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.