• Creator: guest3103
• Population: 0
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 10/30/2020
• Genome: CCGCCACTGACTAGAAATCCTTTGGGGCCG
• Function:

  divide(product(mean(2 *(sin(numbers("yxx"))), sin(numbers("yxx"))), 2 *(sin(numbers("yxx")))), mean(2 *(sin(numbers("yxx"))), sin(numbers("yxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.