• Creator: flasser.dev@gmail.com
• Population: 0
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 10/30/2020
• Genome: CATGAACTGAATACGAAAGGCTGCCTATGT
• Function:

  minus(noise(100 *(numbers("xxx"))) if numbers("xxx") > 100 *(numbers("xxx")) else mean(noise(100 *(numbers("xxx"))), 100 *(numbers("xxx"))), mean(noise(100 *(numbers("xxx"))), 100 *(numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.