header

genetic-algorithms.com

 

Inspect guest3106_0_0_3

Parents

guest3106_0_0_3 has no parents. It was generated at random.

guest3106_0_0_3

Image 01

  • Creator: guest3106
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 10/30/2020
  • Genome: CAGAGGGCATTTATCGCTTGTCCACTAGAA
  • Function:

    minus(tan(numbers('xyy') if band pass(numbers('xyy')) > numbers("yyy") if numbers('xyy') > numbers('ryy') else band pass(numbers('xyy')) else numbers('ryy')), band pass(numbers('xyy')) if numbers('xyy') > numbers('ryy') if numbers('xyy') > band pass(numbers('xyy')) else numbers("yyy") else numbers('ryy'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest3106_0_1_2

Image 01

Genome: CCGAGGGTATTTAACGCTTCGGTACTAGCA