header

genetic-algorithms.com

 

Inspect guest3106_0_0_24

Parents

guest3106_0_0_24 has no parents. It was generated at random.

guest3106_0_0_24

Image 01

  • Creator: guest3106
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 10/30/2020
  • Genome: TGTGACGCGCGGCGACCCAGGAGTGAAAGT
  • Function:

    mod(numbers('yyx'), numbers('yxr')) if mod(numbers('yyx'), numbers('yxr')) if exp(mod(numbers('yyx'), numbers('yxr')), numbers('yyx')) > numbers('yxr') else numbers('yyx') > exp(mod(numbers('yyx'), numbers('yxr')), numbers('yyx')) else numbers('yyx') if exp(mod(numbers('yyx'), numbers('yxr')), numbers('yyx')) if mod(numbers('yyx'), numbers('yxr')) > numbers('yyx') else numbers('yxr') > mod(numbers('yyx'), numbers('yxr')) else exp(mod(numbers('yyx'), numbers('yxr')), numbers('yyx'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest3106_0_1_6

Image 01

Genome: GTGTGTGACGCGCGGACACTCAGGAGTGAAAAT

guest3106_0_1_26

Image 01

Genome: ATATGGGTCGTCATATGCTCCTTACGATGATCG

guest3106_0_1_10

Image 01

Genome: AACGACAATGGGTATCCCAGGAAGCTCAAG

guest3106_0_1_6

Image 01

Genome: GTGTGTGACGCGCGGACACTCAGGAGTGAAAAT