• Creator: guest3106
• Population: 0
• Generation: 1
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 10/30/2020
• Genome: AAGCCCAGTACACCCAATAGGGACGCCTGT
• Function:

  invert(product(gradient[1](gradient[2](product(numbers("yxx"), numbers('yxr')))), gradient[2](product(numbers("yxx"), numbers('yxr')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.