• Creator: VanityMatrix
• Population: 0
• Generation: 0
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: CCCCGGCCCAGGACCAACAGACGATAACTT
• Function:

  product(exp(product(tan(10 *(numbers("xxy"))), 10 *(numbers("xxy"))), tan(10 *(numbers("xxy")))), product(tan(10 *(numbers("xxy"))), 10 *(numbers("xxy"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.