• Creator: VanityMatrix
• Population: 0
• Generation: 2
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 05/19/2019
• Genome: GCACCCAGGGATAACACCAACCGCCGATAACTT
• Function:

  tan(10 *(numbers("xxy")) if square(10 *(numbers("xxy"))) > numbers("xxy") else numbers('xry')) if square(10 *(numbers("xxy"))) > 10 *(numbers("xxy")) if square(10 *(numbers("xxy"))) > numbers('xry') else numbers("xxy") else product(tan(square(10 *(numbers("xxy"))) if numbers("xxy") > 10 *(numbers("xxy")) else numbers('xry')), numbers('xry') if square(10 *(numbers("xxy"))) > numbers("xxy") else 10 *(numbers("xxy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.