header

genetic-algorithms.com

 

Inspect VanityMatrix_0_2_13

Parents

Mother

Image 01

VanityMatrix_0_1_24

Genome: CCCAGGCCCCTGACCAACAGACGATAACTT

Father

Image 01

VanityMatrix_0_1_27

Genome: GGCTCAGATAACCGACCGAAAATATGAGTC

VanityMatrix_0_2_13

Image 01

  • Creator: VanityMatrix
  • Population: 0
  • Generation: 2
  • Total Fitness: 4
  • No. Votes: 1
  • Avg. Fitness 4
  • Created: 05/19/2019
  • Genome: GCACCCAGGGATAACACCAACCGCCGATAACTT
  • Function:

    square(10 *(numbers("xxy"))) if tan(numbers("xxy") if numbers('xry') > 10 *(numbers("xxy")) else square(10 *(numbers("xxy")))) > numbers("xxy") if square(10 *(numbers("xxy"))) > 10 *(numbers("xxy")) else numbers('xry') else product(tan(10 *(numbers("xxy")) if square(10 *(numbers("xxy"))) > numbers("xxy") else numbers('xry')), numbers('xry') if numbers("xxy") > 10 *(numbers("xxy")) else square(10 *(numbers("xxy"))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

VanityMatrix_0_3_1

Image 01

Genome: CTCCCACTCTAATCTCTTCATCACCGCCGGTGAGCT

VanityMatrix_0_3_8

Image 01

Genome: ACACGTCCCAGGGATAGCGCCAGTTCTATACGC

VanityMatrix_0_3_13

Image 01

Genome: GATCAGCCTGCCGTTCTTCTTGACCGCCGATATCGA

VanityMatrix_0_3_18

Image 01

Genome: CTTGCAGTTCGACGAGCCAGTTCTATACGA

VanityMatrix_0_3_25

Image 01

Genome: GACTCGTTGGTTAAGGTATGTAAACGCCGATTC