• Creator: VanityMatrix
• Population: 0
• Generation: 2
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: AGCCTTAATTCTACGCCTGGATGCTGTATACCA
• Function:

  cos(round(noise(100 *(divide(numbers("xxr"), numbers('xry'))) if numbers("xxr") > numbers('xry') else divide(numbers("xxr"), numbers('xry'))), numbers("xxr") if numbers('xry') > divide(numbers("xxr"), numbers('xry')) else 100 *(divide(numbers("xxr"), numbers('xry')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.