header

genetic-algorithms.com

 

Inspect VanityMatrix_0_2_23

Parents

Mother

Image 01

VanityMatrix_0_1_22

Genome: CGTAGGGAACGCTCATACTCTGTAATATTATAC

Father

Image 01

VanityMatrix_0_1_17

Genome: CGCAAGGCGATTCTTGATGGAACTCGCGTGGGT

VanityMatrix_0_2_23

Image 01

  • Creator: VanityMatrix
  • Population: 0
  • Generation: 2
  • Total Fitness: 4
  • No. Votes: 1
  • Avg. Fitness 4
  • Created: 05/19/2019
  • Genome: CTTCGTAGGGAGCGCCCATACTCTGTATGCGTGGGG
  • Function:

    round(log(tan(round(product(numbers("xxy"), numbers('xyy')), numbers("xxy")) if numbers("xxy") > numbers('xyy') else product(numbers("xxy"), numbers('xyy'))), round(product(numbers("xxy"), numbers('xyy')), numbers("xxy")) if numbers("xxy") > numbers('xyy') else product(numbers("xxy"), numbers('xyy'))), tan(round(product(numbers("xxy"), numbers('xyy')), numbers("xxy")) if numbers("xxy") > product(numbers("xxy"), numbers('xyy')) else numbers('xyy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

VanityMatrix_0_3_24

Image 01

Genome: GGCCCTCCCCGACGCCCATACTTCCTACCCATC