• Creator: guest105
• Population: 0
• Generation: 3
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: TTTGAAGAGAGAACGCGCTCTAGCAAGGGCCCC
• Function:

  numbers('xyy') if 100 *(round(numbers('xyy'), numbers('xry'))) > round(numbers('xyy'), numbers('xry')) else sin(100 *(round(numbers('xyy'), numbers('xry')))) if sin(100 *(round(numbers('xyy'), numbers('xry')))) > sin(100 *(round(numbers('xyy'), numbers('xry')))) if numbers('xyy') > round(numbers('xyy'), numbers('xry')) else 100 *(round(numbers('xyy'), numbers('xry'))) if round(numbers('xyy'), numbers('xry')) > 100 *(round(numbers('xyy'), numbers('xry'))) else sin(100 *(round(numbers('xyy'), numbers('xry')))) else 100 *(round(numbers('xyy'), numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.