• Creator: guest105
• Population: 0
• Generation: 3
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: TTTGAAGAGAGAACGCGCTCTAGCAAGGGCCCC
• Function:

  round(numbers('xyy'), numbers('xry')) if 100 *(round(numbers('xyy'), numbers('xry'))) > 100 *(round(numbers('xyy'), numbers('xry'))) if round(numbers('xyy'), numbers('xry')) > numbers('xyy') else sin(100 *(round(numbers('xyy'), numbers('xry')))) else sin(100 *(round(numbers('xyy'), numbers('xry')))) if sin(100 *(round(numbers('xyy'), numbers('xry')))) > round(numbers('xyy'), numbers('xry')) if sin(100 *(round(numbers('xyy'), numbers('xry')))) > 100 *(round(numbers('xyy'), numbers('xry'))) else numbers('xyy') else 100 *(round(numbers('xyy'), numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.