• Creator: camrobjones
• Population: 6
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: TTGCCATGTCTCACGTTGAAGACAGTGATT
• Function:

  product(min(100 *(numbers('epe')), numbers('epe')) if numbers("xyx") > 100 *(numbers('epe')) else numbers('epe'), min(100 *(numbers('epe')), numbers('epe'))) if min(100 *(numbers('epe')), numbers('epe')) if numbers("xyx") > numbers('epe') else 100 *(numbers('epe')) > min(100 *(numbers('epe')), numbers('epe')) else 100 *(numbers('epe'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.