• Creator: camrobjones
• Population: 6
• Generation: 0
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: TATTTTCGCACTAAGCACCCGACCGCGTGC
• Function:

  2 *(invert(numbers("xxy"))) if invert(numbers("xxy")) > 2 *(invert(numbers("xxy"))) if invert(numbers("xxy")) > round(2 *(invert(numbers("xxy"))), invert(numbers("xxy"))) else numbers("xxy") else round(2 *(invert(numbers("xxy"))), invert(numbers("xxy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.