header

genetic-algorithms.com

 

Inspect camrobjones_6_0_18

Parents

camrobjones_6_0_18 has no parents. It was generated at random.

camrobjones_6_0_18

Image 01

  • Creator: camrobjones
  • Population: 6
  • Generation: 0
  • Total Fitness: 27
  • No. Votes: 3
  • Avg. Fitness 9
  • Created: 05/19/2019
  • Genome: TTTACACTTAACTATACCAAGCCTCAGGAA
  • Function:

    round(square(numbers("xyx") if numbers('yyx') > numbers("xyx") else numbers('xyy')), numbers('yyx') if numbers('xyy') > numbers("xyx") else numbers("xyx")) if numbers('xyy') if numbers("xyx") > numbers("xyx") else numbers('yyx') > square(numbers("xyx") if numbers('xyy') > numbers("xyx") else numbers('yyx')) else gradient[2](round(square(numbers('xyy') if numbers("xyx") > numbers('yyx') else numbers("xyx")), numbers("xyx") if numbers('yyx') > numbers('xyy') else numbers("xyx")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

camrobjones_6_1_8

Image 01

Genome: GTTTTTACACTTCACTATACCAAGCCTCAGGAA

camrobjones_6_1_5

Image 01

Genome: GATTTTACACTTAACATTAGTAAACCTCAGGAA

camrobjones_6_1_19

Image 01

Genome: CAACTTAAGTCATCCTCGACGTCGACCATCTCT

camrobjones_6_1_7

Image 01

Genome: GAATTACCATGTCTCACTACGAAGACAGTGATT