header

genetic-algorithms.com

 

Inspect guest3559_0_2_10

Parents

Mother

Image 01

guest3559_0_1_25

Genome: CGTTCGGTGAGAACCCAGCAGTACTCTCTA

Father

Image 01

guest3559_0_1_17

Genome: TTAAGGTTAACTGGTGTCCCAGTGGGCAGT

guest3559_0_2_10

Image 01

  • Creator: guest3559
  • Population: 0
  • Generation: 2
  • Total Fitness: 3
  • No. Votes: 1
  • Avg. Fitness 3
  • Created: 01/16/2021
  • Genome: CGTTTGGTGAGAACCCAGCATTACTCTTAA
  • Function:

    log(sin(10 *(numbers("xyx"))) if 10 *(numbers("xyx")) > numbers("xyx") else numbers("yxx") if 10 *(numbers("xyx")) > sin(10 *(numbers("xyx"))) else numbers("xyx"), sin(10 *(numbers("xyx"))) if 10 *(numbers("xyx")) > numbers("xyx") else numbers("yxx"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest3559_0_2_10 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!