header

genetic-algorithms.com

 

Inspect guest3559_0_3_8

Parents

Mother

Image 01

guest3559_0_2_28

Genome: GAGTGAGCTCCGCTTCGTGTGCGACATTAC

Father

Image 01

guest3559_0_2_7

Genome: CACGTCGTCTACACAGGAGGTATTCTGGGCAGC

guest3559_0_3_8

Image 01

  • Creator: guest3559
  • Population: 0
  • Generation: 3
  • Total Fitness: 7
  • No. Votes: 1
  • Avg. Fitness 7
  • Created: 01/16/2021
  • Genome: TACGTCGCTCCGCTTCGTGTGCGACATTCA
  • Function:

    numbers('ryy') if round(numbers('ryy'), numbers('epe')) > round(numbers('ryy'), numbers('epe')) if numbers('epe') > divide(round(numbers('ryy'), numbers('epe')), numbers('ryy')) else numbers('ryy') else divide(round(numbers('ryy'), numbers('epe')), numbers('ryy')) if round(numbers('ryy'), numbers('epe')) > numbers('ryy') if numbers('epe') > round(numbers('ryy'), numbers('epe')) else divide(round(numbers('ryy'), numbers('epe')), numbers('ryy')) else divide(round(numbers('ryy'), numbers('epe')), numbers('ryy'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest3559_0_3_8 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!