• Creator: VanityMatrix
• Population: 1
• Generation: 2
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: CGAAAGCCAACCCACACTGGGCGCCTTCCG
• Function:

  mod(invert(product(10 *(sum(numbers('xyy'), numbers('yxr'))), sum(numbers('xyy'), numbers('yxr')))), product(10 *(sum(numbers('xyy'), numbers('yxr'))), sum(numbers('xyy'), numbers('yxr'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.