header

genetic-algorithms.com

 

Inspect VanityMatrix_1_2_22

Parents

Mother

Image 01

VanityMatrix_1_1_16

Genome: TTGCTGAGTTTAGGCCAGGGGCGCCATATT

Father

Image 01

VanityMatrix_1_1_4

Genome: GTTGTGAGCATAGGCCAGGGCTGTCATAGT

VanityMatrix_1_2_22

Image 01

  • Creator: VanityMatrix
  • Population: 1
  • Generation: 2
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 05/19/2019
  • Genome: CTATTGCTGAGTTTCCGCCAGGGGCGCCATCTT
  • Function:

    max(mean(gradient[1](round(numbers("xyx"), numbers('yxr')) if numbers('xry') > numbers("xyx") else numbers('yxr')), numbers('xry') if numbers("xyx") > round(numbers("xyx"), numbers('yxr')) else numbers('yxr')) if numbers("xyx") if numbers('yxr') > numbers('xry') else round(numbers("xyx"), numbers('yxr')) > round(numbers("xyx"), numbers('yxr')) else gradient[1](numbers('yxr') if numbers("xyx") > round(numbers("xyx"), numbers('yxr')) else numbers('xry')), mean(gradient[1](numbers('yxr') if numbers('xry') > round(numbers("xyx"), numbers('yxr')) else numbers("xyx")), round(numbers("xyx"), numbers('yxr')) if numbers('xry') > numbers("xyx") else numbers('yxr')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

VanityMatrix_1_2_22 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!