• Creator: VanityMatrix
• Population: 1
• Generation: 2
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: CGGCAGCCTAGGCGTCCATGCTGGACACAT
• Function:

  exp(minus(divide(tan(log(numbers("yyy"), numbers('xry'))), log(numbers("yyy"), numbers('xry'))), tan(log(numbers("yyy"), numbers('xry')))), divide(tan(log(numbers("yyy"), numbers('xry'))), log(numbers("yyy"), numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.