• Creator: VanityMatrix
• Population: 1
• Generation: 2
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: AGGCTGCAAAAGCGAGGTAAGCGTCGAGCG
• Function:

  tan(mean(sum(invert(mod(numbers('ryy'), numbers("xyx"))), mod(numbers('ryy'), numbers("xyx"))), invert(mod(numbers('ryy'), numbers("xyx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.