• Creator: guest3737
• Population: 1
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 02/27/2021
• Genome: AACATGCAGCGGCCGAGTACTTGTGTCTGG
• Function:

  square(sqrt(minus(exp(divide(numbers('ryy'), numbers('xyy')), numbers('ryy')), divide(numbers('ryy'), numbers('xyy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.