header

genetic-algorithms.com

 

Inspect global_global_0_0_61

Parents

global_global_0_0_61 has no parents. It was generated at random.

global_global_0_0_61

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 60
  • No. Votes: 8
  • Avg. Fitness 7.5
  • Created: 05/19/2019
  • Genome: TCCGCTTACACTATAAGTACAACAATTTTG
  • Function:

    logn(numbers('ryy')) if numbers('ryy') if 2 *(logn(numbers('ryy'))) > logn(numbers('ryy')) if 2 *(logn(numbers('ryy'))) > numbers("yyy") else numbers('ryy') else logn(numbers('ryy')) > numbers("yyy") if logn(numbers('ryy')) > numbers('ryy') else 2 *(logn(numbers('ryy'))) else 2 *(logn(numbers('ryy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest4634_0_1_354

Image 01

Genome: CGGTCCGCTTACACTATAAGTACACCAATTTTG

guest200_0_1_341

Image 01

Genome: TCCGCTTACACTATAATCCTCGCAATTTTG

guest195_0_1_300

Image 01

Genome: ATGTCCGCATCCATGGGAAGTACAACAGTTTTGACC

guest75_0_1_262

Image 01

Genome: CCCGCTTACACTATAAGTATCATAATTTTGCGT

sina12345_0_1_210

Image 01

Genome: TTGTCCGCTTAAACTATAAGTAATACAGTCATG

sina12345_0_1_138

Image 01

Genome: TCCGTTTACACTATAAGTACAACAGTGTTG

guest30_0_1_53

Image 01

Genome: TCCGCTTACACTGTGAATACAGCAAAGTGG

camrobjones_0_1_36

Image 01

Genome: CACTCCGCTTACACTATAAGTACCGTTTACGTC

guest200_0_1_337

Image 01

Genome: CCTAGCGCGCTGATTGCCTTGTATCCATCCTAA

sina12345_0_1_142

Image 01

Genome: TCATCAGTCTAGGCTACGCCGCGGTCTCCC

sina12345_0_1_139

Image 01

Genome: TTGTCTCGCGTTAACAAAAGTGGGTGCTCC

guest30_0_1_55

Image 01

Genome: ATTCACTTCCAGGAACGTCTTGCGGCCGCTTTA

camrobjones_0_1_38

Image 01

Genome: TGTATAAGCGGTGATGGCGCATACTAACCC