• Creator: guest3841
• Population: 0
• Generation: 0
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 03/18/2021
• Genome: CACAAAGTTACTCGAATTGCTTCCATTGCC
• Function:

  sum(abs(numbers('xyy') if mod(numbers('rrr'), numbers('xyy')) > numbers('rrr') else 2 *(mod(numbers('rrr'), numbers('xyy')))), numbers('xyy') if mod(numbers('rrr'), numbers('xyy')) > numbers('rrr') else 2 *(mod(numbers('rrr'), numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.