• Creator: guest120
• Population: 0
• Generation: 0
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 05/19/2019
• Genome: ATGCCTGCGATGACGGCCTTCACATTATAA
• Function:

  sqrt(divide(numbers('rep') if sqrt(100 *(numbers('yyx'))) > numbers('yyx') else 100 *(numbers('yyx')), sqrt(100 *(numbers('yyx')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.