• Creator: tquinlan
• Population: 0
• Generation: 0
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: TGTATGATAACTCGGGTCCCGACAGACACT
• Function:

  2 *(exp(numbers('rep'), numbers('yxy'))) if sqrt(logn(2 *(exp(numbers('rep'), numbers('yxy'))))) > exp(numbers('rep'), numbers('yxy')) else logn(2 *(exp(numbers('rep'), numbers('yxy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.