header

genetic-algorithms.com

 

Inspect global_global_0_0_64

Parents

global_global_0_0_64 has no parents. It was generated at random.

global_global_0_0_64

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 24
  • No. Votes: 5
  • Avg. Fitness 4.8
  • Created: 05/19/2019
  • Genome: GCAGCAACGTATGACAAGCACGAGGTACAG
  • Function:

    100 *(numbers("xyx") if numbers("xxy") > numbers("xxy") if numbers("xyx") > numbers("per") else numbers("xyx") else numbers("xyx")) if numbers("xyx") if numbers("xxy") > numbers("xyx") else numbers("xxy") if numbers("xyx") > numbers("per") else numbers("xyx") if numbers("xyx") if numbers("per") > numbers("xxy") else numbers("xyx") > 100 *(numbers("xyx") if numbers("xyx") > numbers("per") else numbers("xxy") if numbers("xyx") > numbers("xxy") else numbers("xyx")) else numbers("xyx") > numbers("xxy") if numbers("per") > numbers("xyx") else numbers("xyx") else numbers("xyx") if numbers("xxy") > numbers("xyx") else numbers("xxy") if numbers("per") > numbers("xyx") else numbers("xyx")

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest195_0_1_326

Image 01

Genome: CGTACCGCAACGTATGTCAAGCAACTGTTACAG

sina12345_0_1_245

Image 01

Genome: CTGGCGCCCGGCACTAAACGTGAGGAGGTACAG

sina12345_0_1_189

Image 01

Genome: TTGGCAGCACATCTTCTATCGCACGAGGTACTG

guest52_0_1_103

Image 01

Genome: TAAGCGGCCACTTACACGATAAGTACCGTACAG

camrobjones_0_1_34

Image 01

Genome: GCGTCTCGTGAGGGCCAGGCGGAGGTACAG

sina12345_0_1_188

Image 01

Genome: AGATCCCGAAACCATAAGCACGAGACTGGT

sina12345_0_1_173

Image 01

Genome: GCGAGAGCGTATGACAAGCAAGAGGTAAAA

sina12345_0_1_149

Image 01

Genome: TGACATACGTATGACTACCGTTGGCTAGTG

guest52_0_1_106

Image 01

Genome: GCGTAGCAGATACTCCTCACCCGTGTGGCGGCA

guest30_0_1_89

Image 01

Genome: GGTGTTTTGCCCCAGTTGCATGAGGTACGG

camrobjones_0_1_39

Image 01

Genome: CCCCTAACCGACGATGATACCATTGCGTCTCTC

camrobjones_0_1_37

Image 01

Genome: TTCGAAATTACAGGATACCACGAGGTGCCA