• Creator: tquinlan
• Population: 0
• Generation: 3
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: TAGGCACAGACTAGCTTCCCCCATGTTGCC
• Function:

  minus(2 *(cos(numbers('rep'))), cos(numbers('rep'))) if cos(numbers('rep')) > 2 *(cos(numbers('rep'))) else cos(numbers('rep')) if 2 *(cos(numbers('rep'))) > numbers('rep') else minus(2 *(cos(numbers('rep'))), cos(numbers('rep')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.