• Creator: tquinlan
• Population: 0
• Generation: 4
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: CAAATGCACCAGACTAAAGGATCCTGCAGG
• Function:

  sum(sqrt(sum(minus(2 *(numbers("xxx")), numbers("xxx")), 2 *(numbers("xxx")))), sum(minus(2 *(numbers("xxx")), numbers("xxx")), 2 *(numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.