• Creator: guest3961
• Population: 0
• Generation: 0
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 04/10/2021
• Genome: AATACCAGCGACAGTACTCACTTCAGAGGG
• Function:

  noise(10 *(cos(numbers("xxy") if numbers('rep') > numbers('xyy') else gradient[1](numbers('xyy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.