header

genetic-algorithms.com

 

Inspect tquinlan_0_5_7

Parents

Mother

Image 01

tquinlan_0_4_12

Genome: TGAGATTACCGAAAAAATAGAAGCTGGCGGCCA

Father

Image 01

tquinlan_0_4_13

Genome: CACTAGGTGACAAAATAATGCTGACAACAACTTCAC

tquinlan_0_5_7

Image 01

  • Creator: tquinlan
  • Population: 0
  • Generation: 5
  • Total Fitness: 3
  • No. Votes: 1
  • Avg. Fitness 3
  • Created: 05/19/2019
  • Genome: CTCTGCTACGTCACAAAAAATAGAAGCTGGCGGCCA
  • Function:

    min(gradient[2](abs(numbers("yxx"))) if gradient[2](abs(numbers("yxx"))) if abs(numbers("yxx")) > gradient[2](abs(numbers("yxx"))) if abs(numbers("yxx")) > numbers("yxx") else numbers("xxr") else numbers("yxx") > abs(numbers("yxx")) else numbers("xxr") if gradient[2](abs(numbers("yxx"))) > abs(numbers("yxx")) else numbers("yxx"), gradient[2](abs(numbers("yxx"))) if numbers("xxr") if abs(numbers("yxx")) > numbers("yxx") else gradient[2](abs(numbers("yxx"))) > numbers("yxx") else abs(numbers("yxx")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

tquinlan_0_6_24

Image 01

Genome: CTCTAGTAAGTGTCAAAATAGGAAGACTCAAGGCAG