header

genetic-algorithms.com

 

Inspect guest3961_0_1_27

Parents

guest3961_0_1_27 has no parents. It was generated at random.

guest3961_0_1_27

Image 01

  • Creator: guest3961
  • Population: 0
  • Generation: 1
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 04/10/2021
  • Genome: GTACGAGCTCGCGGGTTGGTAGAGACTATA
  • Function:

    numbers("per") if numbers("xyx") > numbers('epe') else numbers('xyy') if mod(round(numbers('epe') if numbers("per") > numbers("xyx") else numbers('xyy'), numbers('epe')) if numbers('epe') > numbers("per") else numbers('epe') if numbers("per") > numbers('xyy') else numbers("xyx"), round(numbers('epe') if numbers('xyy') > numbers("per") else numbers("xyx"), numbers('epe'))) > numbers("per") if numbers("per") if numbers("xyx") > numbers('xyy') else numbers('epe') > numbers('epe') else round(numbers("per") if numbers('xyy') > numbers('epe') else numbers("xyx"), numbers('epe')) else round(numbers('epe') if numbers("xyx") > numbers('xyy') else numbers("per"), numbers('epe'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest3961_0_1_27 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!