• Creator: guest3962
• Population: 0
• Generation: 0
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 04/10/2021
• Genome: CCAGTTTTAACTCTAGCATCTACCCTCAAG
• Function:

  product(numbers("yyy") if numbers('xyy') > 2 *(max(numbers("yyy"), numbers('xyy'))) else max(numbers("yyy"), numbers('xyy')) if max(numbers("yyy"), numbers('xyy')) > 2 *(max(numbers("yyy"), numbers('xyy'))) else numbers("yyy"), max(numbers("yyy"), numbers('xyy')) if numbers("yyy") > numbers('xyy') else 2 *(max(numbers("yyy"), numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.