• Creator: guest3962
• Population: 0
• Generation: 0
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 04/10/2021
• Genome: CAGTACACCCAAATATCTGAGACACAAACT
• Function:

  minus(logn(numbers('xyy')) if numbers('xyy') > 10 *(sum(logn(numbers('xyy')), numbers('xyy'))) else sum(logn(numbers('xyy')), numbers('xyy')), 10 *(sum(logn(numbers('xyy')), numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.