header

genetic-algorithms.com

 

Inspect tquinlan_0_5_23

Parents

Mother

Image 01

tquinlan_0_4_24

Genome: TAGGACTTGCCGCGAAACCATGCTCTTGCC

Father

Image 01

tquinlan_0_4_21

Genome: CCTGTGAGTTCCATGTCACATCAGTACAGATGACAG

tquinlan_0_5_23

Image 01

  • Creator: tquinlan
  • Population: 0
  • Generation: 5
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 05/19/2019
  • Genome: ACGTAGGACTTTCCGCGCAACCATGCTCTTGCC
  • Function:

    100 *(numbers("yxx") if round(numbers("xxy"), numbers("yxx")) > divide(round(numbers("xxy"), numbers("yxx")), numbers("xxy")) else numbers("xxy") if round(numbers("xxy"), numbers("yxx")) > numbers("xxy") else divide(round(numbers("xxy"), numbers("yxx")), numbers("xxy")) if round(numbers("xxy"), numbers("yxx")) > divide(round(numbers("xxy"), numbers("yxx")), numbers("xxy")) else numbers("yxx") if round(numbers("xxy"), numbers("yxx")) > numbers("xxy") else divide(round(numbers("xxy"), numbers("yxx")), numbers("xxy")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

tquinlan_0_5_23 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!