• Creator: guest3962
• Population: 0
• Generation: 3
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 04/10/2021
• Genome: GTTGAGGGAACAACGGCGCCTGGACTGACC
• Function:

  gradient[2](100 *(numbers('yxy'))) if 100 *(numbers('yxy')) > numbers('yxy') if 100 *(numbers('yxy')) > numbers('xyy') else gradient[2](100 *(numbers('yxy'))) else numbers('yxy') if gradient[2](100 *(numbers('yxy'))) > 100 *(numbers('yxy')) else numbers('xyy') if gradient[2](100 *(numbers('yxy'))) > numbers('yxy') else 100 *(numbers('yxy'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.